Ywhaq^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ywhaq^em1(IMPC)J
• Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907862
• Gene: Ywhaq Location: Chr12:21440330-21467437 bp, - strand Genetic Position: Chr12, 8.31 cM
• Alliance: Ywhaq^em1(IMPC)J page
• IMPC: Ywhaq gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TGTATTCTGGATTTACCCGT, AGTTTTTTGCTATAAACCAT, GAATCATTTAAGGCCTGCCG, which resulted in a 294 bp deletion beginning at Chromosome 12 negative strand position 21,398,513 bp, GCCTGCCGGGGAAGCTAGTA, and ending after TAAGTATATTTGACCCACGG at 21,398,220 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290283 (exon 2) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an additional 2 bp intronic deletion (CC) 19 bp before the 294 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 98 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ywhaq Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)