Zfp385b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp385b^em1(IMPC)J
• Name: zinc finger protein 385B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907974
• Gene: Zfp385b Location: Chr2:77240966-77648050 bp, - strand Genetic Position: Chr2, 45.94 cM
• Alliance: Zfp385b^em1(IMPC)J page
• IMPC: Zfp385b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGATATGTTTCCCTCAC, AACACATATTGCTTCCTGTG, CACCTCGTAGATAAATGCTG, and AGGAAGGTGAGACCAGTCAA, which resulted in a 447 bp deletion beginning at Chromosome 2 negative strand position 77,450,461 bp, ACCTCGTAGATAAATGCTGG, and ending after ATATGATATGTTTCCCTCAC at 77,450,015 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000326653 (exon 4) and 284 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp intronic deletion (GTTGACTG) 108 bp before the 447 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp385b Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)