Zfp385bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp385bem1(IMPC)J |
Name: |
zinc finger protein 385B; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5907974 |
Gene: |
Zfp385b Location: Chr2:77240966-77648050 bp, - strand Genetic Position: Chr2, 45.94 cM
|
Alliance: |
Zfp385bem1(IMPC)J page
|
IMPC: |
Zfp385b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGATATGTTTCCCTCAC, AACACATATTGCTTCCTGTG, CACCTCGTAGATAAATGCTG, and AGGAAGGTGAGACCAGTCAA, which resulted in a 447 bp deletion beginning at Chromosome 2 negative strand position 77,450,461 bp, ACCTCGTAGATAAATGCTGG, and ending after ATATGATATGTTTCCCTCAC at 77,450,015 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000326653 (exon 4) and 284 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp intronic deletion (GTTGACTG) 108 bp before the 447 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 5 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|