Tm2d3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tm2d3^em1(IMPC)J
• Name: TM2 domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907977
• Gene: Tm2d3 Location: Chr7:65343204-65351650 bp, + strand Genetic Position: Chr7, 35.26 cM, cytoband C
• Alliance: Tm2d3^em1(IMPC)J page
• IMPC: Tm2d3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTCGTATGTAGCATCGA, TAGGGCCTAGCAGTTCATAT, GATGGCCCTGGACCCACCTG and CGCAGGTCTACAAGACAAGG, which resulted in a 516 bp deletion beginning at Chromosome 7 positive strand position 65,697,589 bp, CTATATGAACTGCTAGGCCC, and ending after CAGACTAGCTTCCAGCGACA at 65,698,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200011 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic insertion TT 20 bp before the deletion and a 22 bp intronic deletion (CACCTGGGGCATCGCTTGCTTT) that is replaced with a 23 bp insertion (ATCGCTGGAAGCTAGTCTGAGAA 7:65,698,083-65,698,102) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 92 and early truncation 59 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tm2d3 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)