About   Help   FAQ
Rr198em1Takas
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr198em1Takas
Name: regulatory region 198; endonuclease-mediated mutation 1, Shuji Takada
MGI ID: MGI:5908022
Synonyms: deltaCS1, Igs20em1Takas
Gene: Rr198  Location: Chr12:109489982-109490419 bp  Genetic Position: Chr12, Syntenic
Alliance: Rr198em1Takas page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsTwo sgRNAs (targeting GCCTCTTTGGTTTCCCCACC and GCATTCCGGATCTTTCTGAC flanking the region were used with the CRISPR/Cas9 system to create deletions. The deletion in this allele is 438 bp. (J:241393)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr198 Mutation:  0 strains or lines available
References
Original:  J:241393 Saito T, et al., Deletion of conserved sequences in IG-DMR at Dlk1-Gtl2 locus suggests their involvement in expression of paternally expressed genes in mice. J Reprod Dev. 2017 Feb 16;63(1):101-109
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory