Rr200^em1Takas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr200^em1Takas
• Name: regulatory region 200; endonuclease-mediated mutation 1, Shuji Takada
• MGI ID: MGI:5908025
• Synonyms: deltaCS3, Igs22^em1Takas
• Gene: Rr200 Location: Chr12:109498268-109498626 bp Genetic Position: Chr12, Syntenic
• Alliance: Rr200^em1Takas page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Two sgRNAs (targeting CTGTGGAAACAGCCATAAG' and GCAAGAGCGCCAGTTTTTCA) flanking the region were used with the CRISPR/Cas9 system to create deletions. The deletion in this allele is 359 bp of endogenous sequence but an additional 56 bp were inserted, creating a net deletion of 303 bp. (J:241393)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr200 Mutation: 0 strains or lines available

References

• Original: J:241393 Saito T, et al., Deletion of conserved sequences in IG-DMR at Dlk1-Gtl2 locus suggests their involvement in expression of paternally expressed genes in mice. J Reprod Dev. 2017 Feb 16;63(1):101-109
• All: 1 reference(s)