Cdh7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdh7^em1(IMPC)J
• Name: cadherin 7, type 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5909204
• Gene: Cdh7 Location: Chr1:109910161-110067887 bp, + strand Genetic Position: Chr1, 50.73 cM
• Alliance: Cdh7^em1(IMPC)J page
• IMPC: Cdh7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGATTTCACATTGTATATTC, GACCACGCCTGCACATAGAA and GAAAGAAGCTAGTATGCCAT, which resulted in a total deletion of 650 bp beginning at Chromosome 1 positive strand position 110,048,663 bp GTATATTCTGGCTTCTTAGC, and ending after TTTAATAAATGGCTTGTGTA at 110,049,333 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292496 (exon 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor. Additionally, 55 bp after the end of this exon there is 21 bp of retained endogenous sequence (GTGCAGGCGTGGTCAGAAAGG) followed by an additional 144 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 70 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdh7 Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)