Exoc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exoc2^em1(IMPC)J
• Name: exocyst complex component 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5909206
• Synonyms: Exoc2^-
• Gene: Exoc2 Location: Chr13:30968421-31162082 bp, - strand Genetic Position: Chr13, Syntenic
• Alliance: Exoc2^em1(IMPC)J page
• IMPC: Exoc2 gene page

Exoc2^em1(IMPC)J/Exoc2^em1(IMPC)J mice exhibit embryonic lethality after E3.5 but before E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTAAAATTAAAGAACCAAA, ATATTTAGGGATATCCCACAand GTATTTGTTATAAGGCCAGC, which resulted in a 346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117295 (exon 4) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Exoc2 Mutation: 62 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)