About   Help   FAQ
Fnbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fnbp1em1(IMPC)J
Name: formin binding protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5909220
Gene: Fnbp1  Location: Chr2:30916218-31032020 bp, - strand  Genetic Position: Chr2, 21.78 cM, cytoband B
Alliance: Fnbp1em1(IMPC)J page
IMPC: Fnbp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Fnbp1-8741J-1502M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTGTCCTCCTCCAAAGACA, TCTGGCCTGAGAATAAACAG and TTACAACCCAAACCCGGCCA, which resulted in a 397 bp deletion beginning at Chromosome 2 negative strand position 31,096,377 bp, CTGAGAATAAACAGAGGCAG, and ending after CAAAGACAAGGATGTTCTAC at 31,095,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001281997 (exon 4) and 249 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fnbp1 Mutation:  334 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory