Retnlg^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Retnlg^em1(IMPC)J
• Name: resistin like gamma; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5909238
• Gene: Retnlg Location: Chr16:48692984-48694859 bp, + strand Genetic Position: Chr16, 30.75 cM
• Alliance: Retnlg^em1(IMPC)J page
• IMPC: Retnlg gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Retnlg-8758J-9754M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GAGATCACTGAGCTATGGGA, TGAAAGTATTTACTGCATTG and AAGAGCTTAGACCAGGGTAC, which resulted in a 243 bp deletion beginning at Chromosome 16 positive strand position 48,872,815 bp ATAGCTCAGTGATCTCATCT, and ending after GAGCTTTTGCTGATGCTGAC at 48,873,057 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980093 (exon 2) and 91 bp of flanking intronic sequence including the splice acceptor, ATG start site and splice donor. In addition there is a single bp insertion, A, 216 bp before the deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause an early truncation after 6 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Retnlg Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)