Thap1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Thap1^em1(IMPC)J
• Name: THAP domain containing, apoptosis associated protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5909270
• Gene: Thap1 Location: Chr8:26648197-26654179 bp, + strand Genetic Position: Chr8, 14.4 cM
• Alliance: Thap1^em1(IMPC)J page
• IMPC: Thap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCTGGTTACCAATCTCCCTC, TTTAGTAAGCCGGAGAGTGTand TGTGTTCATGGGAAAAATCA, which resulted in a 597 bp deletion beginning at Chromosome 8 positive strand position 26,160,640 bp, GGGAGATTGGTAACCAGAACT, and ending after TGTTCATGGGAAAAATCAGG at 26,161,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000250934 (exon 2) and 401 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Thap1 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)