About   Help   FAQ
Dhtkd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhtkd1em1(IMPC)J
Name: dehydrogenase E1 and transketolase domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910309
Gene: Dhtkd1  Location: Chr2:5901030-5947648 bp, - strand  Genetic Position: Chr2, 3.62 cM
Alliance: Dhtkd1em1(IMPC)J page
IMPC: Dhtkd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TAGTGGCGAGCGATCTTTGC, GTTTGTAATGGAGCTCACGG and CCGCCCAGAAGGGAAGTCGA, which resulted in a 597 bp deletion beginning at Chromosome 2 negative strand position 5,931,083 bp ACGGTGGAAGCAGCAGAGGC, and ending after TTCCTGCAAAGATCGCTCGC at 5,930,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605446 (exon 3) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dhtkd1 Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory