Acox3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acox3^em1(IMPC)J
• Name: acyl-Coenzyme A oxidase 3, pristanoyl; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910374
• Gene: Acox3 Location: Chr5:35740293-35772397 bp, + strand Genetic Position: Chr5, 18.32 cM, cytoband B1
• Alliance: Acox3^em1(IMPC)J page
• IMPC: Acox3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTCCAGACAAGCTGACAG, TTTTGTTAGGACTCTTACCA, GCTTAAGCCGCTGTTCCCAG and GTCACACCCTGAGAGACCCG, which resulted in a 687 bp deletion beginning at Chromosome 5 positive strand position 35,594,039 bp and ending after 35,594,725 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185499 (exon 8) and 598 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 231 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Acox3 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)