Gramd1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gramd1b^em1(IMPC)J
• Name: GRAM domain containing 1B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910393
• Gene: Gramd1b Location: Chr9:40204529-40442679 bp, - strand Genetic Position: Chr9, 21.42 cM, cytoband B
• Alliance: Gramd1b^em1(IMPC)J page
• IMPC: Gramd1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACCTTCTACTACCATGA, GGGAGTTCCAGAGAACACTC, CTTGGCCTCCCAGAGACTAT and GCAATGGACCCACATACTAT, which resulted in a 474 bp deletion beginning at Chromosome 9 negative strand position 40,317,723 bp and ending after 40,317,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256460 (exon 5) and 389 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp insertion (GGTAGTAGAA) at the deletion site that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 229 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gramd1b Mutation: 120 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)