Lins1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lins1^em1(IMPC)J
• Name: lines homolog 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910408
• Gene: Lins1 Location: Chr7:66339637-66367004 bp, + strand Genetic Position: Chr7, 36.08 cM
• Alliance: Lins1^em1(IMPC)J page
• IMPC: Lins1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAACACAGGATAGAAGTGA, ATACACCACACGCCACTCCA and CCTGAGGTGGTAATCCTTTG, which resulted in a disrupted deletion of 466 bp in total beginning at Chromosome 7 positive strand position 66,709,117 bp and deleting 197 bases then 3 endogenous bp (GGT) are retained, followed by an additional deletion of 269 bp ending at 66,709,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273824 (exon 5) and 327 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lins1 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)