Zhx1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zhx1^em1(IMPC)J
• Name: zinc fingers and homeoboxes 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910464
• Gene: Zhx1 Location: Chr15:57910399-57939904 bp, - strand Genetic Position: Chr15, 24.25 cM, cytoband D2
• Alliance: Zhx1^em1(IMPC)J page
• IMPC: Zhx1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GAAGCGGAAGCTTTCTAAAT and AAAATCAACAACACCTTGCA, which resulted in a 2585 bp deletion beginning at Chromosome 15 negative strand position 58,054,823 bp and ending at 58,052,239 bp (GRCm38/mm10). This mutation deletes 2585 bp of ENSMUSE00000125822 (exon 3) coding sequence and is predicted to cause a change of amino acid sequence after residue 8 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zhx1 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)