Ndufa9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ndufa9^em1(IMPC)J
• Name: NADH:ubiquinone oxidoreductase subunit A9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910587
• Synonyms: Ndufa9^-
• Gene: Ndufa9 Location: Chr6:126798826-126826107 bp, - strand Genetic Position: Chr6, 61.92 cM, cytoband F3
• Alliance: Ndufa9^em1(IMPC)J page
• IMPC: Ndufa9 gene page

Ndufa9^em1(IMPC)J/Ndufa9^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTTTAGAACTTGACCA, GGACTCACGGGTGCTCCACA, GTATTGACAATGAGTAGGCC and GCCTTAGGAAAAATTACTTT, which resulted in a 416 bp deletion beginning at Chromosome 6 positive strand position 126,840,391 bp and ending after 126,840,806 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240808 (exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ndufa9 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)