Cep192^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep192^em1(IMPC)J
• Name: centrosomal protein 192; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910590
• Gene: Cep192 Location: Chr18:67933177-68018241 bp, + strand Genetic Position: Chr18, 40.11 cM, cytoband E1
• Alliance: Cep192^em1(IMPC)J page
• IMPC: Cep192 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGACTGGATAAGTATGT, GATTATTCTCTTTGGAGCTG, TGCTTCACTTACCAACAGCA and GCAGTGTTTTGGTTTGTCAC, which resulted in a 391 bp deletion beginning at Chromosome 18 positive strand position 67,807,133 bp and ending after 67,807,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332162 (exon 5) and 242 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (T) intronic deletion 69 bp before the 391 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 97 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cep192 Mutation: 75 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)