Cdk2ap2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdk2ap2^em1(IMPC)J
• Name: cyclin dependent kinase 2 associated protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910604
• Gene: Cdk2ap2 Location: Chr19:4147182-4149019 bp, + strand Genetic Position: Chr19, 3.8 cM
• Alliance: Cdk2ap2^em1(IMPC)J page
• IMPC: Cdk2ap2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCACGTAGAGCTTGTAGG, CCCGGATTGCAAAACTCGAG, CATAAGGAGGTGCCACCAGG and AAAGGGCCCTTCCTGTAGAT, which resulted in a 1715 bp deletion beginning at Chromosome 19 positive strand position 4,097,571 bp and ending after 4,099,285 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249854, ENSMUSE00001264241, ENSMUSE00000145584 (exons 2-4) and 961 bp of flanking intronic sequence including the splice acceptors and donors and may cause a change of amino acid sequence after residue 27 and early truncation 30 amino acids later by translation of unspliced mRNA. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdk2ap2 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)