Wnk2^em1Murr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wnk2^em1Murr
• Name: WNK lysine deficient protein kinase 2; endonuclease-mediated mutation 1, Stephen Murray
• MGI ID: MGI:5911092
• Gene: Wnk2 Location: Chr13:49189779-49301490 bp, - strand Genetic Position: Chr13, 25.07 cM, cytoband B1
• Alliance: Wnk2^em1Murr page
• IMPC: Wnk2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGATAGAGACTTCACCC, TTCACCCTGGAGCCCCTGCG, CAGCCTTGAGTGACAAGACC and CAAGCCTCACCCAGCAGACC, which resulted in 2 small deletions, a 7 bp (GGCTGAG) deletion beginning at Chromosome 13 positive strand position 49,060,745 bp and ending after 49,060,752 bp, followed 27 bp later by a 6 bp deletion (GTGGAG) beginning at Chromosome 13 positive strand position 49,060,753 bp and ending after 49,060,759 bp (GRCm38/mm10). This mutation deletes 13 total bases in ENSMUSE00000642194 (exon 20) and is predicted to cause a change of amino acid sequence after residue 1538 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wnk2 Mutation: 80 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)