Tnnc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnnc1^em1(IMPC)J
• Name: troponin C, cardiac/slow skeletal; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911233
• Gene: Tnnc1 Location: Chr14:30930274-30933671 bp, + strand Genetic Position: Chr14, 19.09 cM
• Alliance: Tnnc1^em1(IMPC)J page
• IMPC: Tnnc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCCCTCCTCCCCACACTATA, AATGCTAACTGTTCTCTCTC and TGGCCCAAGCAGAGAGGAGA, which resulted in a 222 bp deletion beginning at Chromosome 14 positive strand position 31,210,481 bp and ending after 31,210,702 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001063990(exon 4) and 107 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp intronic deletion (GAGAAG) 18 bp after the 222 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tnnc1 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)