Ccdc191^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc191^em1(IMPC)J
• Name: coiled-coil domain containing 191; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911509
• Gene: Ccdc191 Location: Chr16:43710172-43784677 bp, + strand Genetic Position: Chr16, 28.44 cM, cytoband B4
• Alliance: Ccdc191^em1(IMPC)J page
• IMPC: Ccdc191 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAGTTGTACATTCCGAT, GAGAGTGGTCAGAGCTGTGA, GGTTTAATGCTGAGAAACGA and GCACTCGGAATGTGTTTGCA, which resulted in a 982 bp deletion beginning at Chromosome 16 positive strand position 43,943,264 bp and ending after 43,944,245 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000713202 (exon 9) and 521 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after residue 443. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc191 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)