Dap3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dap3^em1(IMPC)J
• Name: death associated protein 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911513
• Gene: Dap3 Location: Chr3:88828110-88858488 bp, - strand Genetic Position: Chr3, 39.01 cM, cytoband F2
• Alliance: Dap3^em1(IMPC)J page
• IMPC: Dap3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAGGTGACTGCCTGACAG, GTCTGTAGCTGACCCTTGCG, GATGAGTGTAGGAATCTGGT and TAGTGCACATGCGGTTAGAA, which resulted in a 784 bp deletion beginning at Chromosome 3 negative strand position 88,931,104 bp and ending after 88,930,321 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000567034 and ENSMUSE00000567033 (exons 5-6) and 582 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is a 5 bp (CATAT) retention of endogenous sequence that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dap3 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)