Taco1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taco1^em1(IMPC)J
• Name: translational activator of mitochondrially encoded cytochrome c oxidase I; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911953
• Gene: Taco1 Location: Chr11:105956887-105964438 bp, + strand Genetic Position: Chr11, 68.89 cM, cytoband E1
• Alliance: Taco1^em1(IMPC)J page
• IMPC: Taco1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGTATAGGAGAAACAAG, TTCTCCTATACTGTGGTGAG, GACTCCTTAAATTGTCAGGG and GCCCCCAGAGAGTATATGTT, which resulted in a 239 bp deletion beginning at Chromosome 11 positive strand position 106,069,452 bp and ending after 106,069,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108225 (exon 2) and 132 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Taco1 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)