Riok1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Riok1^em1(IMPC)J
• Name: RIO kinase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911955
• Synonyms: Riok1^-
• Gene: Riok1 Location: Chr13:38220971-38245409 bp, + strand Genetic Position: Chr13, 17.91 cM
• Alliance: Riok1^em1(IMPC)J page
• IMPC: Riok1 gene page

Riok1^em1(IMPC)J/Riok1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form normal outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAAAGCCAACACCCACTGA, ATTCATACACCTACTTTCAG and GGGATCCACAACATCTAAGC, which resulted in a 626 bp deletion beginning at Chromosome 13 positive strand position 38,039,914 bp and ending after 38,040,539 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117768 (exon 2) and 424 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small 6 bp (TGAAAG) deletion 121 bp before the 626 bp del that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 23 and early truncation 30 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Riok1 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)