Rpain^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rpain^em1(IMPC)J
• Name: RPA interacting protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911998
• Synonyms: Rpain^-
• Gene: Rpain Location: Chr11:70861039-70868659 bp, + strand Genetic Position: Chr11, 43.21 cM, cytoband B4
• Alliance: Rpain^em1(IMPC)J page
• IMPC: Rpain gene page

Rpain^em1(IMPC)J/Rpain^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocyts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths with few trophectoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTACTGGATAAAATTGGCC, CATTTGTTGTTAGTTCAGCT, GCAAAGGCCAGCATTAGGGT and GGTAGGGAAGACTCTGCCCT, which resulted in a 215 bp deletion beginning at Chromosome 11 positive strand position 70,972,871 bp and ending after 70,973,085 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001257298 (exon 3) and 154 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are a couple of indels including an 11 bp insertion (CTGCTCAGAGA) at the deletion site, and a 4 bp insertion (TCAG) and 15 bp deletion (CTAATGCTGGCCTTT) 31 bp after the exon deletion. These indels will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 84 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rpain Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)