Efcab7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Efcab7^em1(IMPC)J
• Name: EF-hand calcium binding domain 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912016
• Gene: Efcab7 Location: Chr4:99717440-99769985 bp, + strand Genetic Position: Chr4, 45.71 cM
• Alliance: Efcab7^em1(IMPC)J page
• IMPC: Efcab7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACGTAGCCATCAATCAGTG, TCACTAGGTCACTTGGGGCT, TCTAGTAGATTTTTACTGCT and ATCTCAGGTTATCAACAATA, which resulted in a 500 bp deletion beginning at Chromosome 4 positive strand position 99,877,875 bp and ending after 99,878,374 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051035, ENSMUSE00000631831 (exons 2,3) and 220 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is 7 bp insertion at the deletion site (AAGGGGG) that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 77 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Efcab7 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)