Hmgb4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hmgb4^em1(IMPC)J
• Name: high-mobility group box 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912021
• Gene: Hmgb4 Location: Chr4:128154005-128154688 bp, - strand Genetic Position: Chr4, 61.97 cM
• Alliance: Hmgb4^em1(IMPC)J page
• IMPC: Hmgb4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATTGTTTCAAACTGGTCT, TCCCCTTCCTGCCTTGACAT, TGGGGGAAAAAGACCAGCTA and TTCTGAAATTCAGCATAAAA, which resulted in a 401 bp deletion beginning at Chromosome 4 negative strand position 128,260,766 bp and ending after 128,260,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000405638 (exon 1) and additionally inserts 14 bp (TCCCAAGAATGGGG) at the deletion site and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 50 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hmgb4 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)