Clrn2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clrn2^em1(IMPC)J
• Name: clarin 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912027
• Gene: Clrn2 Location: Chr5:45611093-45621491 bp, + strand Genetic Position: Chr5, Syntenic
• Alliance: Clrn2^em1(IMPC)J page
• IMPC: Clrn2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCCTGGATGGTTCAAAA, CAAAAAGGTGTGGTACGGGC, GTGCGGCAATGCGGACTTGG and GGTGCGGCAATGCGGACTTG, which resulted in a 226 bp deletion beginning at Chromosome 5 positive strand position 45,453,820 bp and ending after 45,454,045 bp (GRCm38/mm10). This mutation deletes 226 bp from ENSMUSE00000385096 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Clrn2 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)