About   Help   FAQ
Clrn2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Clrn2em1(IMPC)J
Name: clarin 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912027
Gene: Clrn2  Location: Chr5:45611093-45621491 bp, + strand  Genetic Position: Chr5, Syntenic
Alliance: Clrn2em1(IMPC)J page
IMPC: Clrn2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCCTGGATGGTTCAAAA, CAAAAAGGTGTGGTACGGGC, GTGCGGCAATGCGGACTTGG and GGTGCGGCAATGCGGACTTG, which resulted in a 226 bp deletion beginning at Chromosome 5 positive strand position 45,453,820 bp and ending after 45,454,045 bp (GRCm38/mm10). This mutation deletes 226 bp from ENSMUSE00000385096 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Clrn2 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory