About   Help   FAQ
Csnk1g1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Csnk1g1em1(IMPC)J
Name: casein kinase 1, gamma 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912107
Gene: Csnk1g1  Location: Chr9:65816235-65952297 bp, + strand  Genetic Position: Chr9, 35.6 cM
Alliance: Csnk1g1em1(IMPC)J page
IMPC: Csnk1g1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTGGGAACTATTACTGGG, CTCAGTTTAACTTTTCCAGG, GGTTACAGAGGGTTAACTGA and GCAGCTAATACATCATTAAA, which resulted in a total of 611 bp deletion beginning at Chromosome 9 positive strand position 65,999,223 bp for 48 bp where there is an endogenous 3 bp retention (GGA) followed by 563 bp deletion ending after 65,999,836 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221266 (exon 6) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 29 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Csnk1g1 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory