Csnk1g1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Csnk1g1^em1(IMPC)J
• Name: casein kinase 1, gamma 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912107
• Gene: Csnk1g1 Location: Chr9:65816235-65952297 bp, + strand Genetic Position: Chr9, 35.6 cM
• Alliance: Csnk1g1^em1(IMPC)J page
• IMPC: Csnk1g1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTGGGAACTATTACTGGG, CTCAGTTTAACTTTTCCAGG, GGTTACAGAGGGTTAACTGA and GCAGCTAATACATCATTAAA, which resulted in a total of 611 bp deletion beginning at Chromosome 9 positive strand position 65,999,223 bp for 48 bp where there is an endogenous 3 bp retention (GGA) followed by 563 bp deletion ending after 65,999,836 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221266 (exon 6) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 29 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Csnk1g1 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)