Adgrf3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adgrf3^em1(IMPC)J
• Name: adhesion G protein-coupled receptor F3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912117
• Gene: Adgrf3 Location: Chr5:30398429-30410720 bp, - strand Genetic Position: Chr5, 16.13 cM
• Alliance: Adgrf3^em1(IMPC)J page
• IMPC: Adgrf3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAAGAATCTGAATTCTGA, CTTTCTAGAGACCTCCAGCA, GTACAGGGATAACAAAGAAG and ATGTGGGCCTTGGGTCCAGT, which resulted in a 575 bp deletion beginning at Chromosome 5 negative strand position 30,199,382 bp and ending after 30,198,808 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601748 (exon 8) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 346 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adgrf3 Mutation: 52 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)