Shtn1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shtn1^em1(IMPC)J
• Name: shootin 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912122
• Gene: Shtn1 Location: Chr19:58961788-59064532 bp, - strand Genetic Position: Chr19, 54.56 cM
• Alliance: Shtn1^em1(IMPC)J page
• IMPC: Shtn1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACACCTCCCCATTAGAGC, GCCTGGGCTTCTGTGCAACT, AGCTTTTTAGTCATAGCCAA and ATTATCTGAGATTTAATCAA, which resulted in a 449 bp deletion beginning at Chromosome 19 negative strand position 59,042,109 bp and ending after 59,041,661 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000288532 (exon 4) and 354 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Shtn1 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)