Pkmyt1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pkmyt1^em1(IMPC)J
• Name: protein kinase, membrane associated tyrosine/threonine 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5925317
• Gene: Pkmyt1 Location: Chr17:23945385-23955709 bp, + strand Genetic Position: Chr17, 12.02 cM
• Alliance: Pkmyt1^em1(IMPC)J page
• IMPC: Pkmyt1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTTATCATTGCACGCAG, AATGGTAGTCCCCCAAACCA, GCTGATCAGCCACCAACAAA and GTAGTCCCAGATGTTAACTG, which resulted in a 1036 bp deletion beginning at Chromosome 17 positive strand position 23,733,561 bp and ending after 23,734,596 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136277 (exon 3) and 542 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pkmyt1 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)