About   Help   FAQ
Hspb9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hspb9em1(IMPC)J
Name: heat shock protein, alpha-crystallin-related, B9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5925402
Gene: Hspb9  Location: Chr11:100604755-100605401 bp, + strand  Genetic Position: Chr11, 63.54 cM, cytoband D
Alliance: Hspb9em1(IMPC)J page
IMPC: Hspb9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGCGGGTGCGAAGAGGAA, CGGGGCGGGTGCGAAGAGGA, TCGTTTTGTAAGGAGCTCTT and CCAGTCCCAGAAACCCAGGA, which resulted in a 296 bp deletion beginning at Chromosome 11 positive strand position 100,713,863 bp and ending after 100,714,158 bp (GRCm38/mm10). This mutation generates an internal deletion in ENSMUSE00000891702 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hspb9 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory