Map7d1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Map7d1^em1(IMPC)J
• Name: MAP7 domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5927681
• Gene: Map7d1 Location: Chr4:126125960-126150112 bp, - strand Genetic Position: Chr4, 60.16 cM
• Alliance: Map7d1^em1(IMPC)J page
• IMPC: Map7d1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACACTATACACAAGGCGGT, TGGAAGTGCTGGCAGACGGG, GGAAGTGACTCAAGTCCATG and GATAGGGATCTATCACACAT, which resulted in a 325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 210 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Map7d1 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)