About   Help   FAQ
Impg1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Impg1em1(IMPC)J
Name: interphotoreceptor matrix proteoglycan 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5927700
Gene: Impg1  Location: Chr9:80220612-80347534 bp, - strand  Genetic Position: Chr9, 43.99 cM
Alliance: Impg1em1(IMPC)J page
IMPC: Impg1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAATATCCTAGGAGCAGCA, CCTTAGTAACCATTTCAAAG, TTAAAGTTAGCCATGCAAAA and ATTAGTGTGTGAACATAAGC, which resulted in a 312 bp deletion beginning at Chromosome 9 negative strand position 80,435,559 bp and ending after 80,435,248 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000694908 (exon 3) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Impg1 Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory