Brms1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brms1l^em1(IMPC)J
• Name: breast cancer metastasis-suppressor 1-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5927711
• Gene: Brms1l Location: Chr12:55883109-55916521 bp, + strand Genetic Position: Chr12, 24.18 cM
• Alliance: Brms1l^em1(IMPC)J page
• IMPC: Brms1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATATGAAACTGGACATCCA, CCACTGAGATTCAGTGACGA and TGAGGCCAGTGAGGTTTTGG, which resulted in a 562 bp deletion beginning at Chromosome 12 positive strand position 55,841,295 bp and ending after 55,841,856 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000654815 (exon 2) and 471 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) insertion at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Brms1l Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)