Cacng6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cacng6^em1(IMPC)J
• Name: calcium channel, voltage-dependent, gamma subunit 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5927761
• Gene: Cacng6 Location: Chr7:3472711-3484183 bp, + strand Genetic Position: Chr7, 2.0 cM
• Alliance: Cacng6^em1(IMPC)J page
• IMPC: Cacng6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAAGAGGAAGACCGACGC, AGACCGACGCCGGACAGCTG, GGCGGATGTGCCCGCGGGCA and TGGCAGGCGGATGTGCCCGC, which resulted in a 311 bp internal deletion beginning at Chromosome 7 negative strand position 3,424,975 bp and ending after 3,424,665 bp (GRCm38/mm10). This mutation deletes 311 bp of ENSMUSE00001284940 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cacng6 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)