Kcna6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcna6^em1(IMPC)J
• Name: potassium voltage-gated channel, shaker-related, subfamily, member 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5927763
• Gene: Kcna6 Location: Chr6:126685292-126717610 bp, - strand Genetic Position: Chr6, 61.72 cM
• Alliance: Kcna6^em1(IMPC)J page
• IMPC: Kcna6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATGCTCACCGAGGTTTGA, ATCGAGCTTATGCGGAGAAA, ATCGGAGAAATCCCTGACGC and GGAGAAATCCCTGACGCTGG, which resulted in an internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 with read through the stop to generate a later stop 54 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kcna6 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)