Gpr137^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr137^em1(IMPC)J
• Name: G protein-coupled receptor 137; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6093478
• Gene: Gpr137 Location: Chr19:6915425-6919818 bp, - strand Genetic Position: Chr19, 5.09 cM
• Alliance: Gpr137^em1(IMPC)J page
• IMPC: Gpr137 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCTCTATACTGGACCAAG, TCTGCTGCCGTAACTGTCCC, TGACTCCTCAGGAGACCCCA and GTGAGGGCCGAGGGGATCCG, which resulted in a 841 bp deletion beginning at Chromosome 19 negative strand position 6,939,821 bp and ending after 6,938,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000146635, ENSMUSE00000146628, ENSMUSE00000146634 (exons 3,4,5) and 505 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and read through the stop with a new stop 204 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpr137 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)