Kcnk16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnk16^em1(IMPC)J
• Name: potassium channel, subfamily K, member 16; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6094223
• Gene: Kcnk16 Location: Chr14:20311444-20319267 bp, - strand Genetic Position: Chr14, 11.49 cM, cytoband B
• Alliance: Kcnk16^em1(IMPC)J page
• IMPC: Kcnk16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAATATGCTTTATCCCGG, AATGGACCCCAAGCTCAGCA, CTAAGACACTAAGTGGCCAG and CTTAGGCCCTGGCTTCCCAC, which resulted in a 400 bp deletion beginning at Chromosome 14 positive strand position 20,265,075 bp and ending after 20,265,474 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000239215 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kcnk16 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)