About   Help   FAQ
Dtx3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dtx3em1(IMPC)J
Name: deltex 3, E3 ubiquitin ligase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6094231
Gene: Dtx3  Location: Chr10:127026247-127031597 bp, - strand  Genetic Position: Chr10, 74.5 cM, cytoband D3
Alliance: Dtx3em1(IMPC)J page
IMPC: Dtx3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACCCCCTGGACGCCAGGC, TCTTCCCGCCTGGCGTCCAG, GTCGTTCGTCCTGTCCAGAA and CTGTCCAGAATGGCAGCCTG, which resulted in a 736 bp deletion beginning at Chromosome 10 positive strand position 127,192,621 bp and ending after 127,193,356 bp (GRCm38/mm10). This mutation creates an internal deletion in ENSMUSE00000519601 (exon 4) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 32 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dtx3 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory