Trf^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trf^em1(IMPC)J
• Name: transferrin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6094268
• Gene: Trf Location: Chr9:103086075-103107485 bp, - strand Genetic Position: Chr9, 55.03 cM, cytoband F1-F3
• Alliance: Trf^em1(IMPC)J page
• IMPC: Trf gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCAAACCAGAGGCGTATAG, GCAGGAAGAGGATCATTCCA, GCATCTCTCTAAGCAGCCCA and GATGAATCCGTTCGCCCCAA, which resulted in a 426 bp deletion beginning at Chromosome 9 negative strand position 103,228,289 bp and ending after 103,227,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246941 (exon 2) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trf Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)