Pakap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pakap^em1(IMPC)J
• Name: paralemmin A kinase anchor protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6094831
• Gene: Pakap Location: Chr4:57434475-57896984 bp, + strand Genetic Position: Chr4, 31.66 cM, cytoband C1
• Alliance: Pakap^em1(IMPC)J page
• IMPC: Pakap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGGCTTTCGGTATCTGCT, AGACAACAGATGACACCTTT, CGTGCTGCGACTTTTCCCTG and TCCTAAATAGATACTGGTGT, which resulted in a 292 bp deletion beginning at Chromosome 4 negative strand position 57,648,243 bp and ending after 57,647,952 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001288752 (exon 3) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pakap Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)