Igsf9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igsf9^em1(IMPC)J
• Name: immunoglobulin superfamily, member 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6101173
• Gene: Igsf9 Location: Chr1:172309355-172326445 bp, + strand Genetic Position: Chr1, 79.86 cM
• Alliance: Igsf9^em1(IMPC)J page
• IMPC: Igsf9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTGGCCCATGACTACAAA, GAGAAACTGTATGTGCGGGA, CTGAGTTTAATTCAGCGCTG and CCAGTGTTAGGCAGTGACTG, which resulted in a 1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000361352 through ENSMUSE00000366373 (exons 7-9) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Igsf9 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)