Srbd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Srbd1^em1(IMPC)J
• Name: S1 RNA binding domain 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6101175
• Gene: Srbd1 Location: Chr17:86292093-86452603 bp, - strand Genetic Position: Chr17, 56.51 cM, cytoband E4
• Alliance: Srbd1^em1(IMPC)J page
• IMPC: Srbd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCCTCTTTCACCTGTACA, TGACTATTTTAAGAGTAATG, ATAAACCTACTCATGTCATG and TCTGCTTTAGAATTAAAGGA, which resulted in a 294 bp deletion beginning at Chromosome 17 negative strand position 86,142,597 bp and ending after 86,142,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001033695 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence from the first amino acid and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Srbd1 Mutation: 69 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)