About   Help   FAQ
H2-Ab1g7-em1Dvs
Endonuclease-mediated Allele Detail
Summary
Symbol: H2-Ab1g7-em1Dvs
Name: histocompatibility 2, class II antigen A, beta 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6101479
Synonyms: H2-Ab1em1Dvs
Gene: H2-Ab1  Location: Chr17:34482201-34488392 bp, + strand  Genetic Position: Chr17, 17.98 cM
Alliance: H2-Ab1g7-em1Dvs page
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCas9 RNA and four guide sequences targeting Exon 2 (CCAACGGGACGCAGCGCATA, CGAAGCGCAGGTACTCCTCC, CGACGTGGGCGAGTACCGCG, ACACAACTACGAGGAGACGG) were injected into NOD/ShiLtDvs-H2-K1em1Dvs H2-D1em5Dvs/Dvs embryos yielding this 181bp deletion (ATACGGCTCGTGACCAGATACATCTACAACCGGGAGGAGTACCTGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGT GACCGAGCTGGGGCGGCACTCAGCCGAGTACTACAATAAGCAGTACCTGGAGCGAACGCGGGCCGAGCTGGACACGGCGT GCAGACACAACTACGAGGAGA) within Exon 2 of H2-Ab1. Flow cytometry showed a paucity of CD8+ and CD4+ T-cells in the blood, and flow cytometry showing loss of H2-D, H2-K, and I-A on blood B-cells. (J:257229)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any H2-Ab1 Mutation:  82 strains or lines available
References
Original:  J:257229 Racine JJ, et al., Improved Murine MHC-Deficient HLA Transgenic NOD Mouse Models for Type 1 Diabetes Therapy Development. Diabetes. 2018 May;67(5):923-935
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory