Tsga13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsga13^em1(IMPC)J
• Name: testis specific gene A13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6104246
• Gene: Tsga13 Location: Chr6:30873916-30892508 bp, - strand Genetic Position: Chr6, 12.54 cM
• Alliance: Tsga13^em1(IMPC)J page
• IMPC: Tsga13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTTGAGGCGGTAACAA, TCCCAAGGAAAGATGACATA, GTTAAGTTCCCAAACTTAAA and CCTTTCCTCAACACGCAAGA, which resulted in a 357 bp deletion beginning at Chromosome 6 negative strand position 30,912,374 bp and ending after 30,912,018 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000289889 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 64 bp before the exon deletion there is an indel consisting of a 4 bp insertion, ATAT, and a 7 bp deletion, CGCAAGA, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tsga13 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)