Mfsd4b4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mfsd4b4^em1(IMPC)J
• Name: major facilitator superfamily domain containing 4B4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6104251
• Gene: Mfsd4b4 Location: Chr10:39766009-39775202 bp, - strand Genetic Position: Chr10, 21.27 cM
• Alliance: Mfsd4b4^em1(IMPC)J page
• IMPC: Mfsd4b4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACAACTCAGCTCTAAATG, CAGGGCCCATCGAGTTCCCA, TTATGACTAGAAGGCCACTG and ACTGTAACAAAACCACAGGA, which resulted in a 388 bp deletion beginning at Chromosome 10 negative strand position 39,895,021 bp and ending after 39,894,634 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308224 (exon 2) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mfsd4b4 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)