About   Help   FAQ
Ribc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ribc2em1(IMPC)J
Name: RIB43A domain with coiled-coils 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6104255
Gene: Ribc2  Location: Chr15:85016279-85028771 bp, + strand  Genetic Position: Chr15, 40.25 cM, cytoband E3
Alliance: Ribc2em1(IMPC)J page
IMPC: Ribc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAGGGCTTCACAGAGTAG, AAAGGTTCCCTTCCCATACG, GATAACTGCTTCTTCTTGAG and AGAGGCCGTAAGAAATAGCT, which resulted in a 345 bp deletion beginning at Chromosome 15 positive strand position 85,132,649 bp and ending after 85,132,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126475 (exon 2) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ribc2 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory