Ribc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ribc2^em1(IMPC)J
• Name: RIB43A domain with coiled-coils 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6104255
• Gene: Ribc2 Location: Chr15:85016279-85028771 bp, + strand Genetic Position: Chr15, 40.25 cM, cytoband E3
• Alliance: Ribc2^em1(IMPC)J page
• IMPC: Ribc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAGGGCTTCACAGAGTAG, AAAGGTTCCCTTCCCATACG, GATAACTGCTTCTTCTTGAG and AGAGGCCGTAAGAAATAGCT, which resulted in a 345 bp deletion beginning at Chromosome 15 positive strand position 85,132,649 bp and ending after 85,132,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126475 (exon 2) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ribc2 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)