About   Help   FAQ
Rex1bdem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rex1bdem1(IMPC)J
Name: required for excision 1-B domain containing; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6105940
Gene: Rex1bd  Location: Chr8:70956945-70959402 bp, - strand  Genetic Position: Chr8, 34.15 cM, cytoband C1
Alliance: Rex1bdem1(IMPC)J page
IMPC: Rex1bd gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAAAATAGTAGTAGGTCG, GAGAGGGCCCAAATGCATAG, GGGTGTAGCTTTTAGTAGCA and GTTTGTCTCTTTCGAGTCGG, which resulted in a 554 bp deletion beginning at Chromosome 8 negative strand position 70,506,214 bp and ending after 70,505,661 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291628 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rex1bd Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory